Accessibility Tools

Print
Written by Robert Dickinson
Category: The Bridegroom Cometh
A man standing in a courtroom facing two judges who are out of focus, emphasizing the tension and focus on the individual.

 

Orange circle with a white exclamation mark in the center, symbolizing alert or important notice. Attention: although we advocate for freedom of conscience in matters of receiving the experimental COVID-19 vaccine, we do NOT condone violent protests or violence of any kind. We address this topic in the video entitled God’s Instruction for Protesters Today. We advise being peaceful, maintaining a low profile, and complying with the general health rules that are in effect in your area (such as wearing a mask, washing hands, and maintaining prescribed distances) as long as they do not go against God’s laws, while avoiding situations that would require one to get vaccinated. “Be ye therefore wise as serpents, and harmless as doves” (from Matthew 10:16).

The united global effort—goaded on by the pope—to vaccinate the world with an experimental injection using DNA-related technology is too apocalyptic to be ignored, yet many pacifiers note that “the Bible doesn’t say anything about a vaccine.” Is that true? On the other side are other Christians who see the vaccine as the mark of the beast itself: the ultimate evil to be avoided because the Bible says that those who receive it will be cast into the fires of hell. What is the truth of the matter?

In this article, we will systematically examine the key scriptures and appeal to the Holy Spirit to teach us the meaning of God’s word in relation to the issues of today, in keeping with the Protestant understanding that the Bible can be understood by ordinary people, for which reason many have anciently dedicated their lives to making it widely available.

The first key to understanding the mark of the beast is to recognize that prophecy employs symbols. The events which were future at the time the Bible was written were described by their characteristics using symbols. The next (and related) key is that biblical symbols are biblically defined. The Living Word is self-contained, just as God is self-existent.

With just those basic keys, let us consider a sample Bible verse to show how these keys unlock prophecy. The mark of the beast is introduced in connection with the so-called “second beast” of Revelation 13:

And I beheld another beast coming up out of the earth; and he had two horns like a lamb, and he spake as a dragon. (Revelation 13:11)

As you can see, this prophecy contains symbols. Some are objects—earth, beast, horns, lamb, dragon—and some are actions—coming up, speaking—but these words are ALL symbols. A political animal (a beast[1]) gains prominence (comes up[2]) in a sparsely populated area (earth as opposed to sea[3]) having two pillars of strength (horns[4]) and espousing Christian (lamblike[5]) principles but legislating (speaking[6]) like the devil (a dragon[7]).

The meaning of the symbols in the verse above comes directly from the Bible; just a sample reference text is provided for each symbol in footnotes, but the whole meaning of Scripture bears its weight in giving the definition of every symbol. By understanding the symbols, one can look at the political landscape as it morphed through history and identify the beast that is here spoken of. Bible students have long since made the connections, and their Spirit-led conclusions are still valid.

This beast is the political entity of the United States,[8] which arose in a then sparsely populated region (in contrast to the Old World) as a Christian nation upholding freedom of conscience and freedom of religion and espousing the lamblike principles of Republicanism and Protestantism as its foundation.[9] However, its laws have ever increasingly been resembling the laws of the devil: being gradually formed after the pattern of papal tyranny, until in 2015, the pope—the archenemy whose persecuting power the pilgrim fathers fled from—was ultimately welcomed onto US soil to address the two chambers of the US Congress in joint session, and even the entire world in General Assembly. Today, Joe Biden, as a self-proclaimed devout Catholic, even takes his orders directly from the pope (something that the only previous Catholic president, John F. Kennedy refused to do, for which reason in part he was assassinated).

According to the Bible, it is this nation (the US) who spearheads the mark of the beast agenda of the papacy (the first beast described in Revelation 13[10]):

And he exerciseth all the power of the first beast before him, and causeth the earth and them which dwell therein to worship the first beast, whose deadly wound was healed. (Revelation 13:12)

If Biden’s election does not demonstrate the complete and total healing of the papacy’s wound of the former times when it had lost its global power and influence, it’s hard to imagine what else could! The whole nation is being made to worship or give reverence to the pope through his climate agenda, his economic agenda, his vaccination agenda, and many other things.

And he doeth great wonders, so that he maketh fire come down from heaven on the earth in the sight of men, And deceiveth them that dwell on the earth by the means of those miracles which he had power to do in the sight of the beast; saying to them that dwell on the earth, that they should make an image to the beast, which had the wound by a sword, and did live. (Revelation 13:13-14)

Verse 13 and 14 are a mouthful, but here in these verses we find the first direct mention of the image of the beast. Note that the mark is not yet mentioned, at least not directly. This is interesting for a couple of reasons. First, perhaps this is a hint to the fact that the image of the beast is something more obvious than the mark, which everyone can identify at first sight and which is widely recognized before the mark itself. Secondly, the fact that the Bible distinguishes the mark and the image is significant; it implies that if one does not understand this distinction, then one’s concept of the mark of the beast is surely not yet completely worked out.

Are you ready to understand? The pope stepping foot on US soil in 2015 was NOT the only prophetically significant event that year. That was also the year when the US Supreme Court legalized and protected same-sex marriage on a national level. What was a criminal act punishable by law just a few years ago became a protected “right” according to the nation’s highest court, and the whole land thus became a modern Sodom and Gomorrah.

Before they had gone to bed, all the men from every part of the city of Sodom—both young and old—surrounded the house. They called to Lot, “Where are the men who came to you tonight? Bring them out to us so that we can have sex with them.” (Genesis 19:4-5 NIV)

Do you see how the second beast “spoke”? Do you see how the US called down “fire from heaven”—like an imitation of Elijah; an imitation of the movement of the Holy Spirit—by using its Supreme Court power to deceive churches and religious leaders into accepting or tolerating gay marriage? This happened “in the sight of” the first beast, i.e. in June, in view of the pope’s visit in September of that same year. The pope came during the World Meeting of Families, but he didn’t decry the Supreme Court’s ruling—instead, he gave it his tacit approval.

But what exactly is the image of the beast, and how does the Bible define this symbol? The key to deciphering the image of the beast is to recognize that it is a counterfeit to the image of God:

So God created man in his own image, in the image of God created he him; male and female created he them. (Genesis 1:27)

This is deep.[11] 

But it is also quite clear, and now it is obvious that if man and woman joined in one flesh constitute the image of God, then the image of the beast is nothing other than same-sex marriage.

One can ask, where is the moral stamina in a man like the pope who is supposed to be the bishop of the world church? If presidents and politicians refuse to visit and dialog with rogue nations that are led by dictators, shouldn’t a moral leader take a stand and refuse to visit a land that has corrupted itself like Sodom and Gomorrah, until it shapes up? The only logical conclusion is that the pope was perfectly comfortable in (if not desirous of) a land where the homosexual tradition of his predecessors (the Roman emperors) had just received the protection of the Supreme Court.[12] He condoned it.

Close-up of two hands, one striking a match from a red matchbook, igniting the match head with a visible flame against a blurred background. This begs the question, why didn’t God rain down fire and brimstone on the United States yet (or on the many other countries that followed suit)? The answer is simply that God acts according to due process. As it was in the time of Sodom and Gomorrah, he sent messengers to inspect the condition, and only when the wickedness was confirmed to have reached the critical threshold (somewhere under ten righteous in the city[13]), then He took out Lot and destroyed the cities. But don’t forget: fire and brimstone in prophecy is also a symbol—in this case, a symbol for eternal death. That IS the context, after all:

And the third angel followed them, saying with a loud voice, If any man worship the beast and his image, and receive his mark in his forehead, or in his hand, The same shall drink of the wine of the wrath of God, which is poured out without mixture into the cup of his indignation; and he shall be tormented with fire and brimstone in the presence of the holy angels, and in the presence of the Lamb: And the smoke of their torment ascendeth up for ever and ever: and they have no rest day nor night, who worship the beast and his image, and whosoever receiveth the mark of his name. (Revelation 14:9-11)

It might be noted that it is near certain death of influence to speak against the LGBT corruptions in today’s world. Businesses have been closed because of it. Voices are censored because of it. Accounts and services are terminated because of it. Jobs are lost and people are imprisoned because of it, and so on. The laws that “speak” in protection of LGBT so-called rights are the “cause,” just as the Bible says in its symbolic language:

And he had power to give life unto the image of the beast, that the image of the beast should both speak, and cause that as many as would not worship the image of the beast should be killed. (Revelation 13:15)

But no matter how hard the persecution gets—even to the point of causing physical death—it is better to die in good conscience than to betray God.

And fear not them which kill the body, but are not able to kill the soul: but rather fear him which is able to destroy both soul and body in hell. (Matthew 10:28)

We have covered the verses about the image of the beast. At this point, the prophecy expands to include other aspects:

And he causeth all, both small and great, rich and poor, free and bond, to receive a mark in their right hand, or in their foreheads: And that no man might buy or sell, save he that had the mark [1], or the name [2] of the beast, or the number [3] of his name. (Revelation 13:16-17)

This is the verse that is often misunderstood to indicate that “fill-in-the-blank” is the mark of the beast. This is because anything that limits people’s ability to buy or sell could be shoehorned into an interpretation of this verse. However, the key to remember is that the prophecy still speaks in symbols, and the symbols are biblically defined.

Furthermore, it is significant that in this verse there are actually three elements involved in the trade restrictions: the mark, the name (or image, equivalently), and the number. Not having any of those three things will result in a person being restricted from buying and selling. Therefore, it is important to understand all three of these symbols.

In our video entitled The Threefold Mark of the Beast (below), we surveyed the major interpretations of the mark of the beast, and showed that each of the three sound interpretations that prevail among Protestant Christians today align with the three components identified in the prophecy. In other words, the three main interpretations are all compatible and basically correct, when understood in their proper relation.

First is the observation that God has a “mark” too,[14] which is generally known as His “seal,” which is also placed on the forehead and in the hand and has to do with worship[15] going back to Eden, similarly to how the image of God also goes back to Eden. God instituted divine worship on the seventh day, after He had finished His work of creation, last of which was the creation of man as the pinnacle of His work, made in His image. This work was pronounced “very good,” and God rested and spent the seventh day in communion with Adam, thus instituting the seventh-day Sabbath as the seal of His work as the Creator—the day to be set aside every week for worship of man’s only true God. By contrast, today’s propaganda urges the creation itself—the climate, the earth—to be the object of supreme worship and the highest moral duty of man to protect.

This view of the mark of the beast (in contradistinction to the Sabbath seal) has been soundly studied and vindicated for nearly two centuries, and is the view held by the Seventh-day Adventist Church to this day. An abundance of resources are available on this subject. As a product of this view, members of this church esteem freedom of conscience very highly as all true Protestants do, because they “protest” against the papacy exercising authority over individual conscience—whether it be by dictating the day of the sun for worship, or whether it be (as it is today) substituting not just the sun but the earth that is warmed by it, as the object of worship instead of God.

Because of their understanding of the mark of the beast and their appreciation for liberty of conscience, tens of thousands of people around the world have signed The Liberty of Conscience Document, written by Seventh-day Adventists as an appeal to church leaders to uphold liberty of conscience on the present issue facing them: the vaccination. The document is not doctrinally specific and can be espoused by any Christian church.

And this brings us to the other observation, which is that the present thrust for global vaccination is such an unimaginable infringement of personal freedom on a global scale that it begs to be seen as a fulfillment of prophecy, and indeed many people see it as the mark of the beast itself. It is simply too important to ignore, and if this global affront to God’s sovereignty over mankind doesn’t rank in Bible prophecy, what would?

To bring these concepts together, several points need to be understood. First and foremost is that the Holy Spirit guides into all truth, but the truth is a living thing; it is a way to be followed, and the light of that way is always moving forward in time. As Bible students and believers in Jesus Christ, we can’t allow ourselves to stop on the way. We can’t allow ourselves to stop with Luther’s rediscovery of justification by faith and then reject his discovery that the pope’s seat is that of Antichrist.[16] We can’t stay as mere Lutherans. We cannot allow ourselves to stop with the realization that biblical baptism involves immersion as a symbol of death to self with Christ, from which we also rise in newness of life in Him; we can’t remain mere Baptists. The same could be said of every denomination—we must take the truth for what it is and keep moving forward on the way of salvation, expecting more light on our path as time moves forward. It is never safe to become spiritually stagnant.

This lesson is also for Seventh-day Adventists, who saw the fulfillment of the Sunday law as the mark of the beast in the United States in the 1888-1889 timeframe. But by their careful efforts, they averted this national law by swaying a single vote in Congress that made the difference between passing a national Sunday law vs. not passing it. Freedom of conscience won, and the Sunday law didn’t quite reach national acceptance.

Top image displays a pair of human hands holding a detailed model of Earth against a white background. Middle image shows two joyful men wrapped in a vibrant, multicolored flag. Bottom image features a gloved hand holding a medical syringe, prepared for injection. The lesson, however, is that one cannot rest on their church’s laurels. One must keep moving forward on the way, and that includes recognizing how prophecy is maturing into its present shape today. Biblical symbols are biblically defined, but their application is still a matter of discernment, comparing Scripture with the issues of the day. There is no “Sunday law” written directly in the Bible, just as there is no reference to “vaccines” in the Bible—so how do you know what the mark really is? These applications have to be deduced based on the real-life circumstances that have met the characteristics of the biblically defined symbols, and the fulfillment of prophecy is progressively revealed:

Never did this message apply with greater force than it applies today. More and more the world is setting at nought the claims of God. Men have become bold in transgression. The wickedness of the inhabitants of the world has almost filled up the measure of their iniquity. This earth has almost reached the place where God will permit the destroyer to work his will upon it. The substitution of the laws of men for the law of God, the exaltation, by merely human authority, of Sunday in place of the Bible Sabbath, is the last act in the drama. When this substitution becomes universal, God will reveal Himself. He will arise in His majesty to shake terribly the earth. He will come out of His place to punish the inhabitants of the world for their iniquity, and the earth shall disclose her blood and shall no more cover her slain. {7T 141.1}

Note that in the above quote, the mention of Sunday is a parenthetical statement commenting on the main subject of “substitution” of laws. The law regarding worship was simply the only fulfillment that could be observed in those years, but the progression would continue as “more and more” the laws of men would be substituted for the law of God. Later came the homosexual law and now even the vaccination laws.

The history of the literal Sunday law is long gone, and Seventh-day Adventists need to be open to the fact that the next issue that followed was the image of the beast that manifested in terms of LGBT pride. This substitutes for the seventh commandment and reaches an even wider scope, going both national and international, but not quite worldwide. Can a person honor God by keeping His Sabbath holy while indulging in gay pride? Certainly not! Those who are on God’s side cannot receive the mark OR the image OR the number of the beast. They must have God’s mark AND God’s image AND God’s number.

Note that in each successive test, the reach is greater. The Sunday law reached the national stage in the United States in 1889, when the US Congress was debating it. The LGBT issue has reached very far internationally, but is certainly not universal. The vaccination effort, however, is a global effort with the cooperation of all nations on the earth. In this progressive way, the substitution of the laws of men for the law of God has become universal through the three steps of the mark, image, and number of the beast.

We come now to the pressing issue of the global vaccination effort, which is the most far-reaching of all the three parts of the mark of the beast. This is the part that is associated with the number of the beast:

Here is wisdom. Let him that hath understanding count the number of the beast: for it is the number of a man; and his number is Six hundred threescore and six. (Revelation 13:18)

In all cases, Satan’s counterfeit mark, image, and number are a defacement of the pillars that God established in Eden before sin entered the world: the Sabbath day was established in Eden, the marriage of man and woman in the image of God was established in Eden, and you are about to see that God also established a number in Eden that is defaced by the COVID-19 vaccines.

When God created mankind in the Garden of Eden, He created him with the complete genome of the entire human race. The human genome contains the plans or blueprint for the human body. Scientists liken it to a computer program, as the “operating system” of living beings. The same kind of “program” exists in all living creatures. The genes contained in the first cell of a complex organism contain a set of instructions for how the organism should grow, what kind of symmetry the body should have, when and for how long various members should develop, etc. (Thus, one’s whole identity as a human life is encapsulated in their first cell at conception, whose DNA is formed under the direction of God by recombination from the DNA of a man and a woman.)

Like a computer program, the DNA has an “instruction set.” One gene is formed by a sequence of codons, with each codon formed by three base pairs. Each base pair can be one of four possible values, commonly coded with the letters A, C, G, and T, according to their chemical names. These are analogous to individual “bits” in a computer, except that whereas a computer has a two-value system of 0s and 1s at its most basic level, the code of life has a four-value system of A, C, G, and T.

Scientists say that DNA is the most efficient data storage mechanism known—much more efficient than computer information storage systems. This is because it is very durable and can fold into a very tight structure without getting tangled. To understand how the DNA that God gave us is a number, consider a random sequence consisting of 100 bases (for reference, to write out the entire human genome would require about 6.4 billion letters and would occupy racks of fine-printed books):

Diagram showing the molecular structure of DNA, with a double helix on the left and detailed atomic bonds on the right. Each nucleotide base pair is labeled (cytosine, guanine, adenine, thymine).

GGAGGCGCAGCTTGCAAAAGGTGAAAAAGTC
GTATCGCATCCTGCTATCCCCCGTTACGGCG
GGGGGAGATGGTCACACGCCTTATATGATGA
AGCCCGA

The four letters that make up this code could be written in numeric form, substituting 0, 1, 2, and 3 for A, C, G, and T, respectively:

2202212102133210000223200000231
2303121031132130311111233012212
2222202032231010121133030320320
0211120

This, as you can see, is simply a very large number. In mathematical terms, it is a base 4 number, because each digit can be one of four possible values. By contrast, we humans normally count in a base 10 system. Computers use a base 2 system of zeros and ones, or many other systems such as base 8 (known as octal), base 16 (known as hexadecimal), or base 64.

At its most basic level, the human DNA is a number—a very big number that would occupy several gigabytes of computer storage—and this number originated from God who wrote the original program for the physiological development of the human race, placing it in Adam, whom He formed with His own hand. He wrote the program!

For English speakers, there is an excellent video[17] by Dr. Robert Carter that explains how the DNA is structured in a way that is far more intelligent and efficient than what man has been able to do with computers. DNA is actually a four-dimensional structure: not only is it a linear sequence of base pairs, like a computer program, but it assumes a three-dimensional shape which hides some genes inside itself while exposing other genes to carry out their intended functions. Further, this three-dimensional shape changes in response to bodily conditions, thus adding a fourth dimension of time. In the world of computers, this would be vaguely comparable to self-modifying code—something of a complexity that is avoided by human programmers—not to mention that DNA instructions are “executed” (or performed) in a massively parallel metabolic environment. It is only the mind of the Infinite that could program a system this complex, robust, and efficient—able to adapt to changing circumstances and unforeseen needs.

For mankind to tinker with such a system that is beyond his ability to understand is not only reckless but guaranteed to be disastrous. It would be like a computer illiterate person gaining access to the kernel of a computer’s operating system and randomly changing a few bits here or there—it would almost certainly result in a crash and the inoperability of the system, sooner or later, when that part of the code is executed.

A close-up image depicting a person's face, partially covered in a golden substance, lying on the ground with another person's hand gently touching their face. The setting suggests an outdoor scene with natural light casting shadows over the facial features. Do you see how the great “number” of God—the DNA given to Adam—has been refactored over the generations, through the sexual recombination (meiosis) of the human seed, down to the present time? When this number is augmented or modified through genetic material that is engineered by man, it is no longer the number of God; it becomes the number of a man, the number of the beast system. This blots a being out of the book of life; their DNA no longer matches the pattern established by God. The signature of their genetic code no longer matches the signature of the Creator; it is like a computer program with a trojan.

It has long been observed that the number 666 can be arrived at by summing the Roman numeral letter values of the title Vicarius Filii Dei, the Latin title meaning Vicar (or Representative) of the Son of God. But the fact that the sitting popes—self-proclaimed vicars of Christ—received the COVID-19 vaccine shows that there is more behind this verse. As has been noted in our other articles, the Greek representation of the number 666 in the Bible appears as XEC, which is CEX spelled backwards. The latter is pronounced the same as the word “sex,” suggesting that the number of the beast is a backwards, reversed, opposite, or different sex—namely, a third (non-binary) sex. To put it in other words, if a person’s genetics determine their sex, as God designed, then a person with human-engineered DNA can no longer be strictly defined according to God’s natural definition of a man or a woman; their genes no longer conform to the image of God as male and female.

There is a depth of meaning here that transcends into the supernatural, because Satan is not human. He is a fallen angel, and angels are neither male nor female.[18] It is therefore no surprise that in his diabolical kingdom, he wants everyone to be non-binary, and he is accomplishing that through global vaccination with man-made DNA.

Remember, Satan has a vendetta. As Lucifer, before he was cast out of heaven, he had in mind to rule the universe like the Highest.[19] So when God created man in His image—male and female as an illustration of God and creature in their proper relationship—it tore apart Satan’s world view. He hated mankind (and more so his Creator) from the outset because he recognized that man represented something antithetical to his aspirations.

Therefore, he always wanted to efface the image of God from mankind. Here on earth, he wants the subjects of his kingdom to use gender-inclusive language, because that reflects the language used to refer to heavenly beings which are not gendered. He wants to erase the notion of male and female from the mind of the world, and is doing so by indoctrinating children with gender indifference from infancy forward. In some countries, there has already been a change in the very language—one of the most important components of thought and mental and social development—by outlawing the use of gender-specific expressions.[20] 

But Satan was not able to eradicate the reminder of sex differences completely until now that the technology has advanced sufficiently.[21] By manipulating the DNA, he is literally transforming human beings into beings which are no longer made by God or in the image of God, and thus no longer strictly male or female. Their DNA is altered and their genome is no longer bound by the parameters—the number of God—which He set in Adam.

That this new number is the pope’s number—666, the number of a man—is proof that this man (Pope Francis) is actually a fallen angel. By receiving the vaccine—each dose an act marked on the clock of God—the pope declared who he is. Those who become genderless like him are the constituents of his kingdom. To date, more than half of the world has fallen from the human race and has gotten their “third strand” of “serpent DNA.”

It has been observed that those who received the vaccine no longer have natural immunity against COVID-19.[22] In fact, they suffer worse effects as a result. This means they need booster shots even more, and they are thus dependent on booster shots—and the beast system that supplies them. To choose the tyranny of man as one’s lord means bondage. No obedience? No booster for the next wave, and all dissidents naturally perish or submit.

Thus, all three aspects of the mark of the beast as described in Scripture have met their fulfillment, and the last great test for mankind—the extinction-level event of this generation—has come. Those who will survive it to enter the kingdom of God are not many, but God is on their side. They chose Him instead of the way of death, and He has chosen them in return, to renew His covenant of life with them.

There is only one Way that leads to eternal life. Jesus Christ is that Way. He is the Creator and our Redeemer. In giving His blood, He gave His perfect DNA—His character—to all who would look up to Him, believe, and replicate His nature and character in their own life. This very principle is taught in the foundational studies of the High Sabbath Adventist Society that were developed in the year 2010. In particular, the High Sabbath List (subsequently refined in 2011 and published in 2012), also known as The Vessel of Time or The Gene of Life, deciphers one of the Bible’s most amazing time prophecies that points directly to DNA-compromise as the great and ultimate test for the church.

The Gene of Life is a transcription of the DNA—the character—of Jesus Christ. It highlights the moral issues that are of consequence in the eyes of God, traced with the pen of time. The key to understand the Gene of Life is given in the Bible through the mention of the High Sabbath on which Jesus Christ rested in the tomb between giving His eternal life for mankind and taking it up again as one of the human family.

The Jews therefore, because it was the preparation, that the bodies should not remain upon the cross on the sabbath day, (for that sabbath day was an high day,) besought Pilate that their legs might be broken, and that they might be taken away. (John 19:31)

When any one of the yearly ceremonial sabbath days coincides with the seventh-day Sabbath, it becomes an extra special day called a “High Sabbath” according to the Bible verse above. Recognizing that Jesus died on the Passover day, just before the yearly ceremonial sabbath of the first day of unleavened bread, the beloved apostle informs us that Jesus was hurried down from the cross because that Sabbath day was a High Sabbath.

All throughout the time of the investigation of souls, when God was investigating the character of the dead and living to determine who would be worthy to enter His eternal kingdom, the pages of the divine calendar were turning as the yearly feasts passed by. Every year there was a chance that one or more ceremonial sabbaths might fall on the seventh-day (weekly) Sabbath. Whenever this happened, the resulting days became High Sabbaths, which—like the rungs of the DNA ladder—encoded the message of Christ’s life that was to be transcribed and replicated into His people, so that they would be a perfect reflection of Him.[23] 

A detailed illustration representing a timeline of specific theological events using an intertwined ribbon design, which alternates between sandy and grassy textures. Each loop along the ribbon is marked with a date and theological event, such as “First & Second Angels' Messages” and “Spirit of Prophecy.” The ribbon is interspersed with vertical bars encapsulating elemental symbols.

Because of the High Sabbath List’s deep meaning to the people of God, the movement of those who had received the Orion message decided to call themselves “High Sabbath Adventists” and later formed a society, naming it the High Sabbath Adventist Society. At the time of founding, there was no inkling that DNA- or RNA-containing vaccines would later come into existence, yet the Society’s name was inspired with the foundational belief that the divine DNA of Jesus Christ is the only DNA in which there is eternal life, and that any corruption or deviation from the blueprint He has given us would result in unspeakable tragedy.

Through the Word, we have been given the instruction needed to confront every challenge we face. In 1889 when Alonzo T. Jones defended liberty of conscience before the US Congress and successfully defeated the bill that was to legislate the day on which citizens of the United States must worship, he stood on the firm foundation of Scripture: the liberty of conscience to choose whom to obey[24]—the Creator or the created.[25] Liberty of conscience won, and today, freedom of religion is an integral part of Human Rights laws globally.

The conviction that the seventh day is the Sabbath of the Lord had increased through many years, as the pioneers of the Seventh-day Adventist church studied this theme in the Bible. Their name, too, was inspired in 1863 by their most prominent and unique belief, that God set aside the seventh day for mankind to worship Him, and that Jesus was soon to return for those who so identify themselves with His seal. No other church had that level of understanding at that time.

Today, the High Sabbath Adventists—the remnant of Seventh-day Adventist Church—are the only church who have continued to advance the study of God’s Word to the present and hold in their very name the Bible-based conviction that receiving genetically engineered vaccines would rob them of their identity as sons of God who still hold in their bodies the DNA He gave them, as handed down through the generations, having once been imparted to the first man, Adam. It would rob them of their faith in the One who created the ideal human genome, which cannot be improved upon.

High Sabbath Adventists understand that to despise this gift by receiving man-made DNA would cut them off from the lineage of God, from the hope of eternal life, and from the possibility of salvation through Jesus Christ. To receive the COVID-19 vaccine would take away their entire faith. It would cause them immeasurable agony—the sense that they are eternally lost, experiencing a living damnation. It is worse than death! (There is the hope of resurrection from death, but not from hell.[26] And to think, this lake of fire and brimstone has already burned up half of the world and is still spreading!)

It is a question of faith and conscience. The liberty to choose what goes into the body is a freedom granted by God, and even enshrined in the world’s Human Rights laws. In Eden, God gave Adam and Eve the choice to be sustained by the Tree of Life or to choose the forbidden fruit of the Tree of Knowledge.

And the Lord God commanded the man, saying, Of every tree of the garden thou mayest freely eat: But of the tree of the knowledge of good and evil, thou shalt not eat of it: for in the day that thou eatest thereof thou shalt surely die. (Genesis 2:16-17)

We could say today: of every branch of the human bloodline you may freely intermarry, but to partake of genetic engineering—eating the fruit of knowledge beyond your ken—will kill you off from humanity just as certainly as eating the forbidden fruit led to Adam’s demise.

The great controversy between good and evil has always been a genetic war: a war between the seed of God’s people and the seed of Satan:

And the Lord God said unto the serpent, Because thou hast done this, thou art cursed above all cattle, and above every beast of the field; upon thy belly shalt thou go, and dust shalt thou eat all the days of thy life: And I will put enmity between thee and the woman, and between thy seed and her seed; it shall bruise thy head, and thou shalt bruise his heel. (Genesis 3:14-15)

The mark of the beast, Sunday worship, which was almost legislated as a national mark of Satan’s diabolical authority, challenged liberty of conscience in the US in the 1880’s and it was defeated, giving respite to the nation and world. But in 2015, the image of the beast was successfully set up nationwide and also stands as law in many other lands. Later the same year, the worship of the creation returned in the legally binding Paris Agreement; is the worship of creation not the Sunday law in principle? Is it not universal enough? Is it not legally binding enough?

A black and white image depicting a man with his back to the camera facing a creature resembling a creature from Mazzaroth, possibly inspired by a lion, in a confined space with a door slightly ajar. And now, when confronted with the COVID-19 vaccination—the number of the beast—all nations submit the power over their present and future life to the will of the pope by receiving in their bodies the genetic material that contains the manmade code of Pfizer, Moderna, or any other pharmaceutical entity. In a DNA analysis, they are children of that pharmaceutical witch’s brew—the sorceries of Revelation—which they took. The Savior whose perfect DNA is transcribed in the High Sabbath List says to such:

Ye are of your father the devil, and the lusts of your father ye will do. He was a murderer from the beginning, and abode not in the truth, because there is no truth in him. When he speaketh a lie, he speaketh of his own: for he is a liar, and the father of it. (John 8:44)

The last verse before Revelation 13, which introduces the beast and his mark, is a verse that points to a holy seed under attack:

And the dragon was wroth with the woman, and went to make war with the remnant of her seed, which keep the commandments of God, and have the testimony of Jesus Christ. (Revelation 12:17)

Those who want to keep their seed untainted—as virgin humans, like the 144,000—need to do every peaceable thing in their power to maintain their purity. For this reason, the High Sabbath Adventist Society has responded to the call of The Liberty of Conscience Document and is providing a Request for Religious Vaccination Exemption to members of The Refuge. This is a document that can be presented to employers or any agency that is responsible for ensuring compliance with vaccination mandates. It is available in English, Spanish, and German.

However, it is not a blind pass or a guarantee that your case will turn out favorably; every person stands alone, and employers, judges, and other responsible parties will need to hear your case and question you according to the laws of your nation to determine, for example, whether your faith is genuine and sincerely held[27]—and not merely feigned. Those who refuse vaccination for reasons other than to honor God will have a tough time.

But take heed to yourselves: for they shall deliver you up to councils; and in the synagogues ye shall be beaten: and ye shall be brought before rulers and kings for my sake, for a testimony against them. (Mark 13:9)

We provide ample materials on our study websites[28] for those who wish to better equip themselves. But even if a person successfully defends their conscientious decision on religious grounds, the nature of the employment or circumstance in which they find themselves might be such that an exemption will not be granted, possibly requiring the sacrifice of one’s job or other intention.

These are hard times—times in which the people of God are crying for deliverance. But know that God has not forgotten you.

And what I say unto you I say unto all, Watch [i.e., the clock!]. (Mark 13:37)

Deliverance is near. Until then, you are in our prayers.

1.
Daniel 8:20-21 – The ram which thou sawest having two horns are the kings of Media and Persia. And the rough goat is the king of Grecia: and the great horn that is between his eyes is the first king. 
2.
Daniel 8:3 – Then I lifted up mine eyes, and saw, and, behold, there stood before the river a ram which had two horns: and the two horns were high; but one was higher than the other, and the higher came up last. 
3.
Revelation 17:15 – And he saith unto me, The waters which thou sawest, where the whore sitteth, are peoples, and multitudes, and nations, and tongues. 
4.
Jeremiah 48:25 – The horn of Moab is cut off, and his arm is broken, saith the Lord. 
5.
John 1:36 – And looking upon Jesus as he walked, he saith, Behold the Lamb of God! 
6.
Daniel 7:25 – And he shall speak great words against the most High, and shall wear out the saints of the most High, and think to change times and laws: and they shall be given into his hand until a time and times and the dividing of time. 
7.
Revelation 12:9 – And the great dragon was cast out, that old serpent, called the Devil, and Satan, which deceiveth the whole world: he was cast out into the earth, and his angels were cast out with him. 
8.
A detailed interpretation can be found at CyberspaceMinistry in the study entitled The Beast Rising from the Earth, which is Lesson 66 of “If I Were Told the Future.” 
10.
See The Beast Rising from the Sea, again from CyberspaceMinistries. 
11.
The depth is further expounded in our video entitled The Mark and Image of the Beast which is recommended—along with its accompanying article—for more insight. However, it should be noted that the explanation of the mark itself was not yet completely expounded as of that video or its associated article. (Links to other materials which cover the mark are available later in this article.) 
12.
More on this topic can be found in The Shaking of the Heavens: The Grand Finale 
13.
Genesis 18:32 – And he said, Oh let not the Lord be angry, and I will speak yet but this once: Peradventure ten [righteous] shall be found there. And he said, I will not destroy it for ten’s sake. 
14.
See Ezekiel 9 
15.
In contrast to the wrong worship of Revelation 13:4, 12; 14:9, 11; 16:2. 
16.
The quote is included in The Great Controversy on page 141
18.
Matthew 22:29-30 – Jesus answered and said unto them, Ye do err, not knowing the scriptures, nor the power of God. For in the resurrection they neither marry, nor are given in marriage, but are as the angels of God in heaven. 
19.
Isaiah 14:12-14 – How art thou fallen from heaven, O Lucifer, son of the morning! how art thou cut down to the ground, which didst weaken the nations! For thou hast said in thine heart, I will ascend into heaven, I will exalt my throne above the stars of God: I will sit also upon the mount of the congregation, in the sides of the north: I will ascend above the heights of the clouds; I will be like the most High. 
21.
Daniel 12:4 – But thou, O Daniel, shut up the words, and seal the book, even to the time of the end: many shall run to and fro, and knowledge shall be increased. 
22.
This information comes from experts on both sides of the vaccination question, intentionally or otherwise. Examples include: JVOND – Pfizer Vax Destroys Immune System Business Insider – How a rogue doctor who called the vaccine ‘needle rape’ was made an Idaho public-health official in its worst COVID crisis yet 
23.
While the present article was in preparation, Julie Whedbee received a timely word on this very topic (see video). 
24.
Genesis 2:17 – But of the tree of the knowledge of good and evil, thou shalt not eat of it: for in the day that thou eatest thereof thou shalt surely die.  
25.
Romans 6:16 – Know ye not, that to whom ye yield yourselves servants to obey, his servants ye are to whom ye obey; whether of sin unto death, or of obedience unto righteousness? 
26.
Luke 16:26 – And beside all this, between us and you there is a great gulf fixed: so that they which would pass from hence to you cannot; neither can they pass to us, that would come from thence. 
28.
Our study websites are whitecloudfarm.is and LastCountdown.org. Feel free to also visit our Refuge and/or contact us directly.